View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6548_low_42 (Length: 215)
Name: NF6548_low_42
Description: NF6548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6548_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 6284047 - 6283845
Alignment:
| Q |
1 |
ccgacttcttaagtattgtttcatcctctatattaaaataaattttgtcattcctttgtcaacgaaaaatccctaccgcatccaactatttcctacatac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
6284047 |
ccgacttcttaagtattgtttcatcctctatattaaaataaattttgtcattcctttgtaagcgaaaaatccctactgcatccaactatttcctacctac |
6283948 |
T |
|
| Q |
101 |
tctccctccacatttcctccaggtgtttctggaactatagtacccccttcctctatctataatcaatggaggtgttattggaaaaacctatccttctctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6283947 |
tctccctccacatttcctccaggtgtttccagaactatcgtacccccttcctctatctataattaatggcggtgttattggaaaaacctatccttctctg |
6283848 |
T |
|
| Q |
201 |
ctc |
203 |
Q |
| |
|
||| |
|
|
| T |
6283847 |
ctc |
6283845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University