View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6550_high_15 (Length: 283)
Name: NF6550_high_15
Description: NF6550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6550_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 46716151 - 46716407
Alignment:
| Q |
18 |
aggaccattgttcttccttcttgcaacgggttctctgtagcatagcagttaaagggaagacatgaagaattgattaaggagatgaatgtgaaaattgaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46716151 |
aggaccattgttcttccttcttgcaacgggttctctgtagcatagcagttaaagggaagacatgaagaattgattaaggagatgaatgtgaaaattgaat |
46716250 |
T |
|
| Q |
118 |
tgttgaagtatgaataagaaaacgttacatgttagcaggatcaaacgacgtcggcgccatagcggaattgatcgagatcgagagttgttgaaacggggtc |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46716251 |
tgttgaagtatgaatgagaaaacgttacatgttagcaggatcaaacgacgtcggcgccatagcggaattgatcgagatcgagagttgttgaaacagggtc |
46716350 |
T |
|
| Q |
218 |
agcagggatttttcccgatacaatatgataacctttttctgaagtgacaagaataat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46716351 |
agcagggatttttcccgatacaatatgataatctttttctgaagtgacaagaataat |
46716407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University