View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6550_high_18 (Length: 251)
Name: NF6550_high_18
Description: NF6550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6550_high_18 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 99 - 251
Target Start/End: Complemental strand, 38645229 - 38645077
Alignment:
| Q |
99 |
tgtccctaataaaacaaggcagccatataacttgttgtgaaattttacatactttaacatcgaaacagaacttgattcctctttatctttatctttgtca |
198 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38645229 |
tgtccctaataaaacaaggcaaccatataacttgttgtgaaattttacatactttaacatcgaaagagaacttgattcctctttatctttatctttgtca |
38645130 |
T |
|
| Q |
199 |
ctagttttttcatcgtcactatcttccttaggattgttgaaattggaaggaac |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38645129 |
ctagttttttcatcgtcactatcttccttaggattgttgaaattggaaggaac |
38645077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University