View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6550_high_7 (Length: 354)
Name: NF6550_high_7
Description: NF6550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6550_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 14 - 336
Target Start/End: Original strand, 7405363 - 7405685
Alignment:
| Q |
14 |
agaggacaatgcatctgcaacgtttttcaacattgcgggtgcagatggaacaattgtggcagattacttgccggaggggtttttgaataggacaaaagac |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7405363 |
agaggacaatgcatccgcaacgtttttcaacattgcgggtgcagatggaacaattatggtagattacttgccgaaggggtttttgaataggacaaaagac |
7405462 |
T |
 |
| Q |
114 |
gtagggctttgtgttcccatgtgggcccctcaagctgaaatattgaaacatccttcaacgggtggttttttgacacattgcggttggaattctgtgttgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7405463 |
gtagggctttgtgttcccatgtgggcccctcaagctgagatattgaaacatccttcaacgggtggttttttgacacattgtggttggaattctgtgttgg |
7405562 |
T |
 |
| Q |
214 |
agagtattcataacggtgttccaatggttgcatggccgctttatgcagagcagaagatgaatgcaactatgttatcagaggagcttggtgtggcggtgaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7405563 |
agagtattcataacggtgttccaatggttgcatggccgctttatgctgagcagaagatgaatgcaactatgttatcagaggagcttggtgtggcggtgaa |
7405662 |
T |
 |
| Q |
314 |
agcgacaacagcggtggcagagg |
336 |
Q |
| |
|
|||||||| | |||||||||||| |
|
|
| T |
7405663 |
agcgacaaaaacggtggcagagg |
7405685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University