View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6550_low_20 (Length: 248)
Name: NF6550_low_20
Description: NF6550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6550_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 36 - 224
Target Start/End: Complemental strand, 41866979 - 41866789
Alignment:
| Q |
36 |
attttccctctatttt-actgcattaattgctaatcactataaccctnnnnnnnnn-ttccctctttctatttgttaagttggaatttcaaactttgcct |
133 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
41866979 |
attttccctctatttttactgcattaattgctaatcactataaccctaaaaaaaaaattccctccttctatttgttaagtttgaatttcaaactttgcct |
41866880 |
T |
|
| Q |
134 |
tgcaatttgttattttccctctacttcatgtgcattaaccgagcattcgttttagcactattagttggcttttcaattgcaaaccaaaatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41866879 |
tgcaatttgttattttccctctacttcatgtgcattaactgagccttggttttagcactattagttggcttttcaactgcaaaccaaaatt |
41866789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 91 - 221
Target Start/End: Complemental strand, 54544049 - 54543919
Alignment:
| Q |
91 |
ttccctctttctatttgttaagttggaatttcaaactttgccttgcaatttgttattttccctctacttcatgtgcattaaccgagcattcgttttagca |
190 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| |||||||||||||||||||||| ||||| |||| ||| || |||||||| |
|
|
| T |
54544049 |
ttccctctttctatttgttaaatttgaatttcaaattttgccttgtcatttgttattttccctctactttgtgtgcgttaattgaggcttgattttagca |
54543950 |
T |
|
| Q |
191 |
ctattagttggcttttcaattgcaaaccaaa |
221 |
Q |
| |
|
|||||||||||| || ||||| |||||||| |
|
|
| T |
54543949 |
ctattagttggcccttgaattgtaaaccaaa |
54543919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University