View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6551_high_10 (Length: 239)
Name: NF6551_high_10
Description: NF6551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6551_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 56 - 198
Target Start/End: Original strand, 950184 - 950327
Alignment:
| Q |
56 |
ccttaacatatgtctttagggcacaagttaacattcttaattttattgtatttcggatttgagatcttagttttactctatatatcttgacatagggacc |
155 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
950184 |
ccttaacatatgtctttaagacacaaattaacattcttaattttattgtatttcggatttgagatcttagttttactctatatatcttgacatagggacc |
950283 |
T |
|
| Q |
156 |
aaaaactctatatcttgacacaaatcattgtta-cgtacagcta |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
950284 |
aaaaactctatatcttgacacaaatcgttgataccgtacagcta |
950327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 89
Target Start/End: Complemental strand, 30033513 - 30033480
Alignment:
| Q |
56 |
ccttaacatatgtctttagggcacaagttaacat |
89 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
30033513 |
ccttaacatatgcctttagggcacaagttaacat |
30033480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University