View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6551_low_8 (Length: 328)
Name: NF6551_low_8
Description: NF6551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6551_low_8 |
 | |
|
| [»] scaffold0061 (1 HSPs) |
| | |
|
| [»] scaffold0017 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 140 - 306
Target Start/End: Complemental strand, 8349622 - 8349456
Alignment:
| Q |
140 |
ttttagttatacgaatatcaacaatggttgtaaaattgtagaaatataatagctagaaagaaataccaagactaaaattctattcataatatctatatca |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349622 |
ttttagttatacgaatatcaacaatggttgtaaaattgtagaaatatattagctagaaagaaatcccaagactaaaattctattcataatatctatatca |
8349523 |
T |
|
| Q |
240 |
ctcagcagcagtgacccacacggccacacccaacataaatcacttgaactaatgtgttttgaagaga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349522 |
ctcagcagcagtgacccacacggccacacccaacataaatcacttgaactaatgtgttttgaagaga |
8349456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 218
Target Start/End: Original strand, 11993658 - 11993749
Alignment:
| Q |
127 |
aattgtagaaatgttttagttatacgaatatcaacaatggttgtaaaattgtagaaatataatagctagaaagaaataccaagactaaaatt |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||| |||||| ||| |||| |||||||||||||| |
|
|
| T |
11993658 |
aattgtagaaatgttttagttatacacatatcaacagtggtggtaaaattgtagaaatattttagctacaaacaaatcccaagactaaaatt |
11993749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 163
Target Start/End: Complemental strand, 44614647 - 44614593
Alignment:
| Q |
109 |
agtgagaaatgcaataaaaattgtagaaatgttttagttatacgaatatcaacaa |
163 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| || |||||||||| |
|
|
| T |
44614647 |
agtgagaaatgcaatacaaattatagaaatgctttagttacacatatatcaacaa |
44614593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 109 - 163
Target Start/End: Original strand, 44793922 - 44793976
Alignment:
| Q |
109 |
agtgagaaatgcaataaaaattgtagaaatgttttagttatacgaatatcaacaa |
163 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| || |||||||||| |
|
|
| T |
44793922 |
agtgagaaatgcaatacaaattatagaaatgctttagttacacatatatcaacaa |
44793976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 148
Target Start/End: Original strand, 27216 - 27253
Alignment:
| Q |
111 |
tgagaaatgcaataaaaattgtagaaatgttttagtta |
148 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27216 |
tgagaaatgcaatacaaattgtagaaatgctttagtta |
27253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 148
Target Start/End: Complemental strand, 171576 - 171539
Alignment:
| Q |
111 |
tgagaaatgcaataaaaattgtagaaatgttttagtta |
148 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
171576 |
tgagaaatgcaatacaaattgtagaaatgctttagtta |
171539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University