View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6552_low_22 (Length: 230)
Name: NF6552_low_22
Description: NF6552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6552_low_22 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 24 - 230
Target Start/End: Complemental strand, 5365107 - 5364901
Alignment:
| Q |
24 |
cgatgataatgaaatcattcagacctattagcaaacctttcaacattatgatcagtcaaattaagcccaaccatggcttcacccaatccacaactaacct |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5365107 |
cgatgataatgaaatcattcagacctattagcaaacctttcaacattatgatcagtcaaattaagcccaaccatagcttcacccaatccacaactaacct |
5365008 |
T |
 |
| Q |
124 |
cagccaaaatctcaggatcactgtaatgagtaacagcttgaacaatcgccctcgctcttttcgccggatccccactcttaaacacaccagaaccaacaaa |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365007 |
cagccaaaatctctggatcactgtaatgagtaacagcttgaacaatcgccctcgctcttttcgccggatccccactcttaaacacaccagaaccaacaaa |
5364908 |
T |
 |
| Q |
224 |
aacacca |
230 |
Q |
| |
|
||||||| |
|
|
| T |
5364907 |
aacacca |
5364901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University