View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6553_low_6 (Length: 423)

Name: NF6553_low_6
Description: NF6553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6553_low_6
NF6553_low_6
[»] chr3 (2 HSPs)
chr3 (18-144)||(14014498-14014624)
chr3 (193-225)||(14014673-14014705)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 5e-63; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 18 - 144
Target Start/End: Original strand, 14014498 - 14014624
Alignment:
18 gtataaacttataacactaaccctaattcctagatttcaaacagagatgcataatgctcgatcaatttcctacatgaaaccaaattacagcaacacacag 117  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14014498 gtataaacttataacactaaccctaattcctagatttcaaccagagatgcataatgctcgatcaatttcctacatgaaaccaaattacagcaacacacag 14014597  T
118 atttcaaatataagtaaatctagcaca 144  Q
    |||||||||||||||||||||||||||    
14014598 atttcaaatataagtaaatctagcaca 14014624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 193 - 225
Target Start/End: Original strand, 14014673 - 14014705
Alignment:
193 cttacgatcctgaagggtatcaaaagccacacg 225  Q
    |||||||||| ||||||||||||||||||||||    
14014673 cttacgatccagaagggtatcaaaagccacacg 14014705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University