View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6555_high_21 (Length: 243)

Name: NF6555_high_21
Description: NF6555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6555_high_21
NF6555_high_21
[»] chr4 (1 HSPs)
chr4 (149-226)||(2656362-2656439)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 149 - 226
Target Start/End: Original strand, 2656362 - 2656439
Alignment:
149 cactaggtacatgaacgaaagtaccatttcaaactggtctcaggttcacatatagttgcaagaacaaatccttgacat 226  Q
    |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
2656362 cactgggtacatgaacgaaagtaccattccaaactggtctcaggttcacatatagttgcaagaacaaatccttgacat 2656439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University