View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6555_low_12 (Length: 324)
Name: NF6555_low_12
Description: NF6555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6555_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 16 - 316
Target Start/End: Complemental strand, 37583870 - 37583570
Alignment:
| Q |
16 |
atataagcgatggcttggttcttctcccttatcaactaactagcttttaagaaatgattcctcaattgcgcagatacttatcaattgatatttgatatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37583870 |
atataagcgatggcttggttcttctcccttatcaactaactagcttttaagaaatgattcctcaattgcgcagatacttatcaattgatatttgatatca |
37583771 |
T |
 |
| Q |
116 |
cagctggattgtcagcatctcgaaaagtttatctacaagggactggtcaaaaaggtcgaatgaaacatcagagtgtagccgttgaaggctttcatgggag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37583770 |
cagctggattgtcagcatctcgaaaagtttatctacaagggactggtcaaaaaggtcgaatgaaacatcagagtgtagccgttgaaagctttcatgggag |
37583671 |
T |
 |
| Q |
216 |
gtgtttttgacagggtcttcaatatcatgggtgcttgttcaactcaagttgaatagtaagaggtactcagtaaagtataaaatggtggcttgattcttct |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37583670 |
gtgtttttgacagggtcttcaatatcatgggtgcttgctcaactcaagttgaatagtaagaggtactcagtaaagtataaaatggtggcttgattcttct |
37583571 |
T |
 |
| Q |
316 |
c |
316 |
Q |
| |
|
| |
|
|
| T |
37583570 |
c |
37583570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University