View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6555_low_16 (Length: 302)
Name: NF6555_low_16
Description: NF6555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6555_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 162 - 260
Target Start/End: Complemental strand, 7462402 - 7462304
Alignment:
| Q |
162 |
ctaacttcaattattgaatatttcttcggtaacatcctcagaatgaatcctaccttaaccacctgctttcctattactctcttagtttcactatctatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||||| |
|
|
| T |
7462402 |
ctaacttcaattattgaatatttcttcggtaacatccccagaatgaatcctaccttaaccacctgctttcctcttactctcttaatttcaatatctatt |
7462304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 2 - 81
Target Start/End: Complemental strand, 7462563 - 7462483
Alignment:
| Q |
2 |
gactactcaccgtatttttg-atacttatccttcttgtattgcacaatatttaatcaataatatccgttaagtttgtttcc |
81 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7462563 |
gactactcaccgtttttttttatacttatccttcttatattgcacaatatttaatcaataatatcagttaagtttgtttcc |
7462483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 106 - 143
Target Start/End: Complemental strand, 7462460 - 7462423
Alignment:
| Q |
106 |
gacaatcatttgtctatggactttgaagctaacctcgt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7462460 |
gacaatcatttgtctatggactttgaagctaacctcgt |
7462423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 19117617 - 19117583
Alignment:
| Q |
8 |
tcaccgtatttttgatacttatccttcttgtattg |
42 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
19117617 |
tcaccgtatttttgattcttatccttcttgtattg |
19117583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 26597370 - 26597329
Alignment:
| Q |
1 |
ggactactcaccgtatttttgatacttatccttcttgtattg |
42 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
26597370 |
ggactaatcaccgtatatttgattcttatccttcttgtattg |
26597329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 5594317 - 5594357
Alignment:
| Q |
1 |
ggactactcaccgtatttttgatacttatccttcttgtatt |
41 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
5594317 |
ggactaatcaccgtattttttattcttatccttcttgtatt |
5594357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University