View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6556_low_3 (Length: 202)
Name: NF6556_low_3
Description: NF6556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6556_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 25926944 - 25927127
Alignment:
| Q |
1 |
atttcataattcatttacattaacatcacactatatatgtagtaaaaacatttggaaactaaagataaatttgcattacaagaagattgagggagaaggt |
100 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25926944 |
atttcataattcatctatattagcatcacactatatatgtagtaaaaacatttggaaactaaagataaatttgcattacaagaagatcgagggagaaggt |
25927043 |
T |
 |
| Q |
101 |
ttttcatccctctcatgtgccgtatgaggaagataggaacacaagatgattgagcaggagaaagttaaaattgatctaaacaat |
184 |
Q |
| |
|
||||||||||||||||||| |||| |||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25927044 |
ttttcatccctctcatgtgtcgtaggaggaatataggaacacaagatgattgagtaggagaaagttaaaattgatctaaacaat |
25927127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University