View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6557_low_2 (Length: 342)
Name: NF6557_low_2
Description: NF6557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6557_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 6 - 228
Target Start/End: Complemental strand, 15592281 - 15592059
Alignment:
| Q |
6 |
aggtgaaggaaacacaaaatcaaatgttgaaataaatgaagatcataacattgatacaagtttgcctaatgatggaactaaggcattcaaagaagagaga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||||| |||| ||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
15592281 |
aggtgaaggaaacacaaaatcaaatgttcaaataaataaagatcagaacaatgatacaagtttgcctagtgatggaactaagacattcaaagaagagaga |
15592182 |
T |
|
| Q |
106 |
tcgttgcagccattgtgaccaaagatactactcaatgcatctggattacttacgatacaagttacaccattgattagaattttattttaatagatatcat |
205 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15592181 |
tcgttgcagccattttgaccaaagatactactcaatgcatctggattacttacgatacaagttaatccattgattagaattttattttaatagatatcat |
15592082 |
T |
|
| Q |
206 |
tgaattagcattagttagattga |
228 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
15592081 |
tgaattcgcattagttagattga |
15592059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University