View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6558_low_10 (Length: 240)
Name: NF6558_low_10
Description: NF6558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6558_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 43395694 - 43395470
Alignment:
| Q |
1 |
tttttcactttcatcttggttacaaaaagttaattgtgcactgaaatattgacatgaacaattaagctgatttctaattttaactagtaaaaagacccgt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43395694 |
tttttcactttgatcttggttacaaaaagttaattgtgcactgaaatattgacatgaacaattaagctgatttctaattttaactagtaaaaagaccctt |
43395595 |
T |
 |
| Q |
101 |
acattcgcaaaataaaataatgatattagaggttaatatctagattctaatatgtatttcgaccagattctttatgcatgaaactaaacatttactaata |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43395594 |
acattcgcaaaataa-----tgatattagaggttaatatctagattctaatatgtatttcgaccagattctttatgcatgaaactaaacatttactaata |
43395500 |
T |
 |
| Q |
201 |
attaaattttatttccttttgttttgatga |
230 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |
|
|
| T |
43395499 |
attaaattttattttcttatgttttgatga |
43395470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University