View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_high_14 (Length: 429)
Name: NF6560_high_14
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_high_14 |
 |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 19652572 - 19652525
Alignment:
| Q |
158 |
aaatagtagttcttgtaaatatttctataaatgctttttgacctcttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19652572 |
aaatagtagttcttgtaaatatttctataaatgctttttgacctcttt |
19652525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 219 - 266
Target Start/End: Complemental strand, 19652253 - 19652207
Alignment:
| Q |
219 |
tttttgacctctatcattatcttagtgaaccttcgagatctgtccaag |
266 |
Q |
| |
|
||||||||| || |||||||||| |||||||||||||||||||||||| |
|
|
| T |
19652253 |
tttttgaccact-tcattatcttggtgaaccttcgagatctgtccaag |
19652207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 12356285 - 12356243
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttccct |
44 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
12356285 |
tatccttaaccagtatctcaggggcaccggttagcatttccct |
12356243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 15186281 - 15186232
Alignment:
| Q |
5 |
ccttaaccagtgtcacaggggcgccggttagcatttccctatcttaattt |
54 |
Q |
| |
|
|||||||||||| | | ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
15186281 |
ccttaaccagtgccccgggggcaccggttagcatttccctttcttaattt |
15186232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 22225890 - 22225930
Alignment:
| Q |
1 |
ttatccttaaccagtgtcacaggggcgccggttagcatttc |
41 |
Q |
| |
|
|||||||||||||||||| | ||||| |||||||||||||| |
|
|
| T |
22225890 |
ttatccttaaccagtgtcccgggggcaccggttagcatttc |
22225930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 13961253 - 13961197
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttccctatcttaatttagaa |
58 |
Q |
| |
|
||||||||||| ||| | | ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
13961253 |
tatccttaacccgtgccccgggggcaccggttagcatttccctatctttatttagaa |
13961197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 29657812 - 29657768
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttccctat |
46 |
Q |
| |
|
||||||||||||||| | | ||||| ||||||||||||||||||| |
|
|
| T |
29657812 |
tatccttaaccagtgccccgggggcaccggttagcatttccctat |
29657768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 35132563 - 35132521
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttccct |
44 |
Q |
| |
|
||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
35132563 |
tatccttaaccagtgtcccgggggcaccggttagcatttccct |
35132521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 42
Target Start/End: Original strand, 6255 - 6295
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttcc |
42 |
Q |
| |
|
||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
6255 |
tatccttaaccagtgccccaggggcaccggttagcatttcc |
6295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 20831698 - 20831742
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttccctat |
46 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||||| |||| |
|
|
| T |
20831698 |
tatccttaaccagtgtcccgggggcaccggttagcatttctctat |
20831742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 3336388 - 3336352
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcat |
38 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
3336388 |
tatccttaaccagtgtcacaagggcaccggttagcat |
3336352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 26891808 - 26891852
Alignment:
| Q |
2 |
tatccttaaccagtgtcacaggggcgccggttagcatttccctat |
46 |
Q |
| |
|
||||||||| ||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
26891808 |
tatccttaatcagtgtcccgggggcaccggttagcatttccctat |
26891852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University