View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_high_32 (Length: 257)
Name: NF6560_high_32
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 221
Target Start/End: Original strand, 1029609 - 1029811
Alignment:
| Q |
19 |
tttacaacccacaaaatttcaacatatttcatttgattacttcatccctattccttttttgtctcgagtcccataaatgactttattagcttccaacatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1029609 |
tttacaacccacaaaatttcaacatatttcatttgattacttcatccctattccttttttgtctcgagtcccataaatgactttattagcttccaacatc |
1029708 |
T |
|
| Q |
119 |
tcttcacattggatatacttattggccctttctagtagatggttgaagtcatgggttgctttgaggccaatactctcggtaaacttggtgtccttcaaga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1029709 |
tcttcacattggatatacttattggccctttctagtagatggttgaagtcatgggttgctttgaggccaatactctcggtaaacttggtgtccttcaaga |
1029808 |
T |
|
| Q |
219 |
gtc |
221 |
Q |
| |
|
||| |
|
|
| T |
1029809 |
gtc |
1029811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 1012383 - 1012434
Alignment:
| Q |
19 |
tttacaacccacaaaatttcaacatatttcatttgattacttcatccctatt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
1012383 |
tttacaacccacaaaatttcaacatatttcatttgattactacatctctatt |
1012434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University