View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_high_47 (Length: 203)
Name: NF6560_high_47
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_high_47 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 184
Target Start/End: Complemental strand, 5887102 - 5886931
Alignment:
| Q |
13 |
gattatactctttccggtttcaaataagtgtctctctttttcaattggatcttaaatttttccctttaaatttaatgataaaatgacacttattttaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5887102 |
gattatactctttccggtttcaaataagtgtctctctttttcaattggatcttaaatttttccctttaaatttaatgataaaatgacacttattttaaaa |
5887003 |
T |
|
| Q |
113 |
gggaagggacggtctacttatttttccctcaacaagatttgaactgtttggactttgcacagatgggcacaa |
184 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5887002 |
cggaagggacggtctactcatttttccctcaacaagatttgaactgtttggactttggacagatgggcacaa |
5886931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University