View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6560_low_15 (Length: 429)

Name: NF6560_low_15
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6560_low_15
NF6560_low_15
[»] chr4 (5 HSPs)
chr4 (158-205)||(19652525-19652572)
chr4 (219-266)||(19652207-19652253)
chr4 (2-44)||(12356243-12356285)
chr4 (5-54)||(15186232-15186281)
chr4 (1-41)||(22225890-22225930)
[»] chr1 (2 HSPs)
chr1 (2-58)||(13961197-13961253)
chr1 (2-46)||(29657768-29657812)
[»] chr5 (1 HSPs)
chr5 (2-44)||(35132521-35132563)
[»] scaffold0188 (1 HSPs)
scaffold0188 (2-42)||(6255-6295)
[»] chr8 (1 HSPs)
chr8 (2-46)||(20831698-20831742)
[»] chr2 (2 HSPs)
chr2 (2-38)||(3336352-3336388)
chr2 (2-46)||(26891808-26891852)


Alignment Details
Target: chr4 (Bit Score: 48; Significance: 3e-18; HSPs: 5)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 158 - 205
Target Start/End: Complemental strand, 19652572 - 19652525
Alignment:
158 aaatagtagttcttgtaaatatttctataaatgctttttgacctcttt 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
19652572 aaatagtagttcttgtaaatatttctataaatgctttttgacctcttt 19652525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 219 - 266
Target Start/End: Complemental strand, 19652253 - 19652207
Alignment:
219 tttttgacctctatcattatcttagtgaaccttcgagatctgtccaag 266  Q
    ||||||||| || |||||||||| ||||||||||||||||||||||||    
19652253 tttttgaccact-tcattatcttggtgaaccttcgagatctgtccaag 19652207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 12356285 - 12356243
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttccct 44  Q
    |||||||||||||| || ||||||| |||||||||||||||||    
12356285 tatccttaaccagtatctcaggggcaccggttagcatttccct 12356243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 5 - 54
Target Start/End: Complemental strand, 15186281 - 15186232
Alignment:
5 ccttaaccagtgtcacaggggcgccggttagcatttccctatcttaattt 54  Q
    |||||||||||| | | ||||| ||||||||||||||||| |||||||||    
15186281 ccttaaccagtgccccgggggcaccggttagcatttccctttcttaattt 15186232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 22225890 - 22225930
Alignment:
1 ttatccttaaccagtgtcacaggggcgccggttagcatttc 41  Q
    |||||||||||||||||| | ||||| ||||||||||||||    
22225890 ttatccttaaccagtgtcccgggggcaccggttagcatttc 22225930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 13961253 - 13961197
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttccctatcttaatttagaa 58  Q
    ||||||||||| ||| | | ||||| |||||||||||||||||||||| ||||||||    
13961253 tatccttaacccgtgccccgggggcaccggttagcatttccctatctttatttagaa 13961197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 29657812 - 29657768
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttccctat 46  Q
    ||||||||||||||| | | ||||| |||||||||||||||||||    
29657812 tatccttaaccagtgccccgggggcaccggttagcatttccctat 29657768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 35132563 - 35132521
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttccct 44  Q
    ||||||||||||||||| | ||||| |||||||||||||||||    
35132563 tatccttaaccagtgtcccgggggcaccggttagcatttccct 35132521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0188
Description:

Target: scaffold0188; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 42
Target Start/End: Original strand, 6255 - 6295
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttcc 42  Q
    ||||||||||||||| | ||||||| |||||||||||||||    
6255 tatccttaaccagtgccccaggggcaccggttagcatttcc 6295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 20831698 - 20831742
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttccctat 46  Q
    ||||||||||||||||| | ||||| |||||||||||||| ||||    
20831698 tatccttaaccagtgtcccgggggcaccggttagcatttctctat 20831742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 3336388 - 3336352
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcat 38  Q
    |||||||||||||||||||| |||| |||||||||||    
3336388 tatccttaaccagtgtcacaagggcaccggttagcat 3336352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 2 - 46
Target Start/End: Original strand, 26891808 - 26891852
Alignment:
2 tatccttaaccagtgtcacaggggcgccggttagcatttccctat 46  Q
    ||||||||| ||||||| | ||||| |||||||||||||||||||    
26891808 tatccttaatcagtgtcccgggggcaccggttagcatttccctat 26891852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University