View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_low_22 (Length: 362)
Name: NF6560_low_22
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 332; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 332; E-Value: 0
Query Start/End: Original strand, 12 - 351
Target Start/End: Complemental strand, 37320583 - 37320244
Alignment:
| Q |
12 |
tgtgtttgtggttcagctggatacttttacagctttggttgtggttctgtgcttccttgcattgatttttaaggagacggtaatgggaggtaagagttca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37320583 |
tgtgtttgtggttcagctggatacttttacagctttggttgtggttctgtgtttccttgcattgattttcaaggagacggtaatgggaggtaagagttca |
37320484 |
T |
 |
| Q |
112 |
aaagggtctcggaggagagatgtaaattcatcatcaccatcaacatcatatggctctgttggttcttcttcatcttcatgggaaaataactatggatatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320483 |
aaagggtctcggaggagagatgtaaattcatcatcaccatcaacatcatatggctctgttggttcttcttcatcttcatgggaaaataactatggatatc |
37320384 |
T |
 |
| Q |
212 |
cacaatcaacatatccataccctccacagcaaaatccatatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320383 |
cacaatcaacatatccataccctccacagcaaaatccatatcaaaggcctaatcaccgtccccctacacaggctccctctcatgattattcacggccgaa |
37320284 |
T |
 |
| Q |
312 |
taggaagttggataggagatattcaaggattgctgatgat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37320283 |
taggaagttggataggagatattcaaggattgctgatgat |
37320244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University