View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_low_27 (Length: 311)
Name: NF6560_low_27
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 141 - 304
Target Start/End: Complemental strand, 38056764 - 38056601
Alignment:
| Q |
141 |
gtgttaagtctatcttgccgaagatttttggatcaaagcgaaatgggagaggctcagacgaagatgcactcaaatcaaatacagaaggagattcaatttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38056764 |
gtgttaagtctatcttgccgaagatttttggatcaaagcgaaatgggagaggctcagacgaagatgcactcaaatcaaatacagaaggagattcaatttc |
38056665 |
T |
 |
| Q |
241 |
aattagttttggtatttattacactagttacttcttaattcccatataataatctattcatttc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38056664 |
aattagttttggtatttattacactagttacttcttaattcccatataataatctattcatttc |
38056601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 15 - 131
Target Start/End: Complemental strand, 38056910 - 38056794
Alignment:
| Q |
15 |
acaaacacctcgcctgacaatagtgtcaagaatgagaaaaagaaaaaggttcttttgctatatacactttctttctttctttgtaattttcctcatgcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38056910 |
acaaacacctcgcctgacaatagtgtcaagaatgagaaaaagaaaaaggttcttttgctatatacactttctttctttctttgtaattttcctcatgcat |
38056811 |
T |
 |
| Q |
115 |
tgcattgttattgagcc |
131 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38056810 |
tgcattgttattgagcc |
38056794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University