View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_low_33 (Length: 271)
Name: NF6560_low_33
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 16 - 231
Target Start/End: Original strand, 27080263 - 27080478
Alignment:
| Q |
16 |
atcacacgactgattaatggacctgaatttgatgttgtagcaaaatcagatagtttgctgcagtagcaaacctcgatcatcaatcttcgatctgaaaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | | |||||||| ||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
27080263 |
atcacacgactgattaatggacctgaatttgatgttgtagcaaatttaaatagtttgttgcagtagcaaaccttgatcatcaatctacgatctgaaaatt |
27080362 |
T |
|
| Q |
116 |
tcaaattcactgcacggatttcaacaatttataatgtcagatcttgaattagctttagctactagttagaaggaataattggagtcttgagcatactcgt |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27080363 |
ccaaattcactgcatggatttcaacaatttatagtgtcagatcttgagttagctttagctactagttagaaggaataattggagtcttgagcatactagt |
27080462 |
T |
|
| Q |
216 |
taactactctacacat |
231 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27080463 |
taactactctacacat |
27080478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 99
Target Start/End: Original strand, 41388870 - 41388935
Alignment:
| Q |
34 |
ggacctgaatttgatgttgtagcaaaatcagatagtttgctgcagtagcaaacctcgatcatcaat |
99 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | ||||| ||||||||||| ||||| ||||||| |
|
|
| T |
41388870 |
ggacctgaatttgatgttgtagcaaattcacacggtttgtcgcagtagcaaatctcgaccatcaat |
41388935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University