View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_low_42 (Length: 251)
Name: NF6560_low_42
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_low_42 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 47120624 - 47120863
Alignment:
| Q |
1 |
attgatggccccctcaggcgacatgaaattcccgtggaagatcaccctttgagcctcgataaggaaagtctttggagacaatattttcaggttagtttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120624 |
attgatggccccctcaggcgacatgaaattcccgtggaagatcaccctttgagcctcgataaggaaagtctttggagacaatattttcaggttagtttct |
47120723 |
T |
|
| Q |
101 |
tctccattttatagttactttggacgccttcaagataatgaagtagatacatatcaccggctacccattttctagcatacagagatagcggaacagatag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47120724 |
tctccattttatagttactttggacgccttcaagataatgaagtggatacatatcaccggctacccattttctagcatacagagatagcagaacagatag |
47120823 |
T |
|
| Q |
201 |
atcgagatttgcagcgcacacatcctgacatgccattctt |
240 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47120824 |
atcgagatttgcagcgcacacatccagacatgccattctt |
47120863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University