View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_low_46 (Length: 241)
Name: NF6560_low_46
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 40626104 - 40626328
Alignment:
| Q |
1 |
caatcaacctcttccagcttcatccatgagtcgcacctttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttcttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40626104 |
caatcaacctcttccagcttcatccatgagtcgcacgtttagcaggaccaatcctttttcagaaagatacaaaatgttttgtgacaacaacacttcttgt |
40626203 |
T |
 |
| Q |
101 |
gctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcgctcatcttttatgcaaccct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40626204 |
gctctctctcttctgtcatcaccagtaccacaaacacatgatcatcctgaaaatggattgaatcagatggtgaatactcactcatcttttatgcaaccct |
40626303 |
T |
 |
| Q |
201 |
taggcttgagtttgcatgaccatag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40626304 |
taggcttgagtttgcatgaccatag |
40626328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University