View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6560_low_47 (Length: 240)

Name: NF6560_low_47
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6560_low_47
NF6560_low_47
[»] chr8 (1 HSPs)
chr8 (112-203)||(43102970-43103061)


Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 112 - 203
Target Start/End: Complemental strand, 43103061 - 43102970
Alignment:
112 taagtgaccacacgaaaccaaatacatgttccttttcaaccatcatggaagaaatgaaatccctaatgatccttgttttcccaatagccata 203  Q
    |||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||    
43103061 taagtgactacaccaaaccaaatacatgttccttttcaaccatcatggaagaaatgaaatccctaatgatgcttgcttttccaatagccata 43102970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University