View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6560_low_52 (Length: 221)
Name: NF6560_low_52
Description: NF6560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6560_low_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 57 - 211
Target Start/End: Original strand, 19138361 - 19138515
Alignment:
| Q |
57 |
tgatgaggttctaagcttcaccagaaaatctgcacactagttcccttctattagaatatgagtaatagagacattggtttgagagatgaggtctttaatg |
156 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19138361 |
tgatgaggttctaagcttcatcagaaaatctgcacgctagttcccttctattagaatatgagtaatagagacaatggtttgagagatgaggtctttaatg |
19138460 |
T |
 |
| Q |
157 |
tcttggattaaaactacatacacctgacaattcacaagggggccattgatgatgt |
211 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19138461 |
tcttggattaaaactacatacatctgacaattcacaagggggccattgatgatgt |
19138515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 17164638 - 17164670
Alignment:
| Q |
27 |
acatcggctggcaaccgatgtaactaaaggtga |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
17164638 |
acatcgggtggcaaccgatgtaactaaaggtga |
17164670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 34693394 - 34693346
Alignment:
| Q |
121 |
atagagacattggtttgagagatgaggtctttaatgtcttggattaaaa |
169 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
34693394 |
atagagacattattttgagagatgaggtctttaatattttggactaaaa |
34693346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University