View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6561_high_21 (Length: 309)
Name: NF6561_high_21
Description: NF6561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6561_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 12403845 - 12404138
Alignment:
| Q |
1 |
gagttattggtcaagctgcttatagggaatggaaatggcatgttgcttcaaataggggtgttgggagtcttaaatatggcaaacaaagtgggttatggat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12403845 |
gagttattggtcaagctgcttatagggaatggaaatggcatgttgcttcaaatatgggtgttgggagtcttaaacatggcaaacaaagtgggttatggat |
12403944 |
T |
|
| Q |
101 |
gaaaattttctctcttctttggccttttcaagggatgaaattaaaggttggtgatggaaatgatagctgcaatcataggagttcattgcctgttgattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12403945 |
gaaaattttctctcttctttggccttttcaagggatgaaattaaaggttggtgatggaaatgatagctgcaatcataggagttcattgcctgttgaagct |
12404044 |
T |
|
| Q |
201 |
gttatgaactggtatcttgctatcgaaactggccgcttctggtttcctgctcaagtctataaccgcgaggtatctatggatattctttggtcat |
294 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12404045 |
gttatgaactggtatcttgcaattgaaactggccgcttctggtttcctgctcaagtctataaccgcgaggtatctatggatattctttggtcat |
12404138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 38728933 - 38728887
Alignment:
| Q |
1 |
gagttattggtcaagctgcttatagggaatggaaatggcatgttgct |
47 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
38728933 |
gagttattggttctgttgcttatagggaatggaaatggcatgttgct |
38728887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University