View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6561_low_33 (Length: 252)
Name: NF6561_low_33
Description: NF6561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6561_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 50609094 - 50609343
Alignment:
| Q |
1 |
ttatttctgcaaaatgttgaaggatctatcaactagtattatacaatttatatagtttttcaaatctatccggcatcaattattgttgatgatcttgtaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50609094 |
ttatttctgcaaaaggttgaaggatctatcaactagtattatacaatttatatagtttttcaaatctatccggcatcaattattgttgatgatcttgtaa |
50609193 |
T |
 |
| Q |
101 |
caaannnnnnnnattgatgttcatgtcgttgttcatatttcaaatcattcgtagcacccgatttagacaaaactttgcaatcatgctctaaatttgctaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50609194 |
caaattttttttattgatgttcatgtcgttgttcatatttcaaatctttcgtagcacccgatttagacaaaactttgcaatcatgctctaaatttgctaa |
50609293 |
T |
 |
| Q |
201 |
atgagtttgag--------acagggaccaattatatttgacatagtataa |
242 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50609294 |
atgaatttgagacactaatacagggaccaattatatttgacatagtataa |
50609343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University