View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6561_low_35 (Length: 251)
Name: NF6561_low_35
Description: NF6561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6561_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 15572230 - 15572003
Alignment:
| Q |
1 |
cacaagagatcatcaacctagcatattattactagtccaaatcatgggatatatatttgttttttgcacacttaaattcaagatttaaatctacaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||| | |||| |
|
|
| T |
15572230 |
cacaagagatcatcaacctagcatattattactagtccaatt-atg---tatatatttgttttttgcacacttaaattcaagatttaaatctagaccaaa |
15572135 |
T |
 |
| Q |
101 |
gtagtagatcatcacatgttagtctactatacggttgcattcactctttgctttattaaaacaaagttagtaaaggaagcaatttcctaatagnnnnnnn |
200 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15572134 |
gtattagatcatcacatgttagtctac--tacggtagcattcactctttgctttattaaaacaaagttagtaaaggaagcaatttcctattagacaaaaa |
15572037 |
T |
 |
| Q |
201 |
tagaaggtagaattaaaattttgaagtgaaatct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15572036 |
tagaaggtagaattaaaattttgaagtgaaatct |
15572003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University