View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6561_low_37 (Length: 250)
Name: NF6561_low_37
Description: NF6561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6561_low_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 39526821 - 39526583
Alignment:
| Q |
1 |
tgttggtttatgttctgtttgaatattataaaggtaggacagagtctctccttttattgcctaaaaactgaattggttaaataataatttcgttaaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39526821 |
tgttggtttatgttctgtttgaatattataaatgtaggacagtgtctctccttttattgcctaaaaactgaattggttaaataataatttcgttaaaagt |
39526722 |
T |
 |
| Q |
101 |
gtttgattatgattgttttgctaataaatagattaagtaatactgaaaattcgtactggtttaccaaaattgccataccttgaagttgttatttcaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39526721 |
gtttgattatgattgttttgctaataaatagattaagtaatactgaaaattcgtactggtttaccaaaattgccataccttgaagttgttatttcaaaac |
39526622 |
T |
 |
| Q |
201 |
catatttagaaggtaaatgtataggttcatgatgatatt |
239 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39526621 |
catatttagaaggtaaatttataggttcatgatgatatt |
39526583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University