View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6561_low_46 (Length: 222)
Name: NF6561_low_46
Description: NF6561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6561_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 39748307 - 39748106
Alignment:
| Q |
1 |
atcagctcaggtttgcaacttcttgttggctattgtttttgagtgtttatttgatatacatacatatatccttaatgnnnnnnnnnnaatattcgtactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
39748307 |
atcagctcaggtttgcaacttcttgttggctgttgtttttgagtgtttatttgatatacata--tatatccttaatgatttttttttaatattcgtactt |
39748210 |
T |
|
| Q |
101 |
tataggaaaccattgaaacaaatcaggctaccatgtttgttcattccgaaagaatctttggcatgctaaatatgatacagcttgaatcaagaattattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39748209 |
tataggaaaccattgaaacaaatcaggctaccatgtttgttcattccgaaagaatctttggcatgctaaatatgatacagcttgaatcaagaattattaa |
39748110 |
T |
|
| Q |
201 |
agct |
204 |
Q |
| |
|
|||| |
|
|
| T |
39748109 |
agct |
39748106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University