View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6562_low_3 (Length: 387)
Name: NF6562_low_3
Description: NF6562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6562_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 94 - 377
Target Start/End: Original strand, 48763700 - 48763983
Alignment:
| Q |
94 |
agaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaacctcatcacaaaattttgaaacaggtcaaccaacttgcc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48763700 |
agaagttgagcagccagagcatacttcttcttccaaaaccaaacctcattccgatgaacaacctcatcacaaaattttgaaacaggtcaaccaacttgcc |
48763799 |
T |
 |
| Q |
194 |
taatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatctattcgtgttgatcatatctccctaaattgcgtctctaca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
48763800 |
taatttcatcttcattccatgttccaattgttcattcatattattatattgttatgtatctattcgtgttgatcatatctctctaaattgcatctctaca |
48763899 |
T |
 |
| Q |
294 |
acttgactagggttttggttgggattttttaggtggagtattatttcagtgatttaaacttggctaccaccgatcatttgatga |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48763900 |
acttgactagggttttggttgggattttttaggtggagtattatttcagcgatttaaacttggctaccaccgatcatttgatga |
48763983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University