View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6563_high_40 (Length: 272)
Name: NF6563_high_40
Description: NF6563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6563_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 259
Target Start/End: Original strand, 27978012 - 27978256
Alignment:
| Q |
15 |
agaaggacctattttgacctactgcaatgtcccaactgctcttcaacattcgattaccagcattatgggagttcaagacgttgttggcaccggtaagtac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27978012 |
agaaggacctattttgacctactgcaatgtcccaactgctcttcaacattcgattaccagcattatgggagttcaagacgttgttggcaccggtaagtac |
27978111 |
T |
 |
| Q |
115 |
ttgggtctcccattgatgattgacagggatcgaacatatgtgttctcttatgataaggattgtgtttggcagagaatatattcttagagaaacagatgtc |
214 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27978112 |
ttaggtctcccattgatgattgacagggatcgaacatatgtgttctcttatgataagtattgtgtttggcagagaatatattcttagagaaacaaatgtc |
27978211 |
T |
 |
| Q |
215 |
tatttaaagcaggaagataaattataatcaaatcagtgttgcagg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27978212 |
tatttaaagcaggaagataaattataataaaatcagtgttgcagg |
27978256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University