View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6563_high_54 (Length: 208)
Name: NF6563_high_54
Description: NF6563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6563_high_54 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 35 - 191
Target Start/End: Complemental strand, 47254474 - 47254319
Alignment:
| Q |
35 |
ctagggctgattgcaatgaagttgtggcaaaatgttaagacgttatcattgtcttggtttatgttaagggggtgtttaagactttaagagtataattgaa |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47254474 |
ctagggctgattgcaatgaagttgtggcaaa-tgttaagacgttatcattgtcttggtttatgttaagggggtgtttaagactttaagagtaaaattgaa |
47254376 |
T |
 |
| Q |
135 |
attcagattgatgtttctacctactcgaatgtttacgaattgaaagatggtgctgat |
191 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47254375 |
attgagattgatgtttctacctacttgaatgtttacgaattgaaagatggtgctgat |
47254319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University