View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6563_low_2 (Length: 773)
Name: NF6563_low_2
Description: NF6563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6563_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 5e-95
Query Start/End: Original strand, 514 - 763
Target Start/End: Complemental strand, 33573177 - 33572930
Alignment:
| Q |
514 |
ttattacggagttggtggaacaagtagtgtt-ataattttaaggttcagaagtatcaatcaagtgaagctatgttatggattcaaaatggacctacatat |
612 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
33573177 |
ttattacggagttggtggaacaagtagtgtttataattttaaggttcagaagtatcaatcaagtgaagctatgttatggattcaaaatggac---cagat |
33573081 |
T |
 |
| Q |
613 |
agaccagatttgattggaattggatggcatgtgagtttcatattgttgatttatatttaa-nnnnnnnatcataaaatatggttttcacacaaaaaatta |
711 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33573080 |
agaccagatttgattggaatt-gatggcatgtgagtttcatattgttgatttatatttaattttttttatcataaaatatggttttcacacaaaaaatta |
33572982 |
T |
 |
| Q |
712 |
attatttatgatttgtcaatttaggtggctccaaaactatacaatgatgatg |
763 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
33572981 |
tttatttatgatttgtcaatttaagtggctccaaaactatacaacgatgatg |
33572930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University