View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6563_low_53 (Length: 219)
Name: NF6563_low_53
Description: NF6563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6563_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 38447715 - 38447911
Alignment:
| Q |
1 |
tgattgataggtgagtagattatgcattgctattctcttttatatatatctattagtgttgccaatattaataatagttttccgtnnnnnnnttatacgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
38447715 |
tgattgataggtgagtagattatgcattgctatac------------atctattagtgttgccaatattaataatagttttctgtaaaaaaattatacgt |
38447802 |
T |
|
| Q |
101 |
taaatttacaattactttcgtcaatttcaggggtggcgctggaattttacctatacttttgactatgcaatctgatctgcctccactccctcagaatcca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38447803 |
taaatttacaattactttcgtcaatttcaggggtggcgctggaatttcacctatacttttgactatgcaatctgatctgcctccactccctcagaatcca |
38447902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 38343019 - 38343063
Alignment:
| Q |
1 |
tgattgataggtgagtagattatgcattgctattctcttttatat |
45 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
38343019 |
tgattgataggtgagttgattatgcaatgccattctcttttatat |
38343063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 38447212 - 38447256
Alignment:
| Q |
1 |
tgattgataggtgagtagattatgcattgctattctcttttatat |
45 |
Q |
| |
|
|||||||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
38447212 |
tgattgataggtgagttgattatgcaatgccattctcttttatat |
38447256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University