View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6563_low_54 (Length: 218)
Name: NF6563_low_54
Description: NF6563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6563_low_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 5479614 - 5479817
Alignment:
| Q |
1 |
acaaatattctgttagatgataaatggatagcaaaggtttccgattttgggctttcgaggattgggcctatgggtatttcgaaagcccatgttagtacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5479614 |
acaaatattctgttagatgataaatggatagcaaaggtttccgattttgggctttcgaggattgggcctatgggtatttcaaaagcccatgttagtacgg |
5479713 |
T |
|
| Q |
101 |
ttgttaaagggagtgttgggtatttagacccggagtattataaacgtcagcgtttgactgagaaatctgatgtttattcttttggtgttgttttgtttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
5479714 |
ttgttaaagggagtgttgggtatttagacccggagtattataaacgtcagcgtttgaccgagaaatctgatgtttactcttttggtgttgttttgttcga |
5479813 |
T |
|
| Q |
201 |
gata |
204 |
Q |
| |
|
|||| |
|
|
| T |
5479814 |
gata |
5479817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University