View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6563_low_56 (Length: 208)

Name: NF6563_low_56
Description: NF6563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6563_low_56
NF6563_low_56
[»] chr4 (1 HSPs)
chr4 (35-191)||(47254319-47254474)


Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 35 - 191
Target Start/End: Complemental strand, 47254474 - 47254319
Alignment:
35 ctagggctgattgcaatgaagttgtggcaaaatgttaagacgttatcattgtcttggtttatgttaagggggtgtttaagactttaagagtataattgaa 134  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
47254474 ctagggctgattgcaatgaagttgtggcaaa-tgttaagacgttatcattgtcttggtttatgttaagggggtgtttaagactttaagagtaaaattgaa 47254376  T
135 attcagattgatgtttctacctactcgaatgtttacgaattgaaagatggtgctgat 191  Q
    ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
47254375 attgagattgatgtttctacctacttgaatgtttacgaattgaaagatggtgctgat 47254319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University