View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6565_low_1 (Length: 537)
Name: NF6565_low_1
Description: NF6565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6565_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 1e-70; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 340 - 524
Target Start/End: Original strand, 42983228 - 42983410
Alignment:
| Q |
340 |
gcccatctctacttttgacatatcaaaagattgattaggattgtaacacnnnnnnnnnncttcactgagtaactcacctatttctataaattatatttca |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
42983228 |
gcccatctctacttttgacatatcaaaagattgattaggattgtaacacttttttttttc--caccgagtaactcgcctatttctataaattatatttca |
42983325 |
T |
 |
| Q |
440 |
ggtttagggtgtgtcaatgagatacatttcttgatttttcttctcttcatcaccaactaatctccataatttacactttcatgat |
524 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983326 |
ggtttagggtgtgtcaatgagatacatttcttgatttttcttctcttcatcaccaactaatctccataatttacactttcatgat |
42983410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 42982888 - 42983052
Alignment:
| Q |
18 |
gttttgggtactctccaggccaggctggtagacgaagcaaaattccagccacgggcattgctctaactttgtgactcatgagattactttttaactctag |
117 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42982888 |
gttttgggtactc--cgggccaggctggtagacgaagcaaaattccagccacgggcattgctctaactttgtgactcgtgagattactttttaactctag |
42982985 |
T |
 |
| Q |
118 |
tatctgtgcattttaaactgaacccgaactgttttaaatcgaaccaaattattattattgtaccgttg |
185 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42982986 |
tatctttgcatttt-aactgaacccgaactgttttaaatcgaaccgaataattattattgtaccgttg |
42983052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 219 - 280
Target Start/End: Original strand, 42983099 - 42983160
Alignment:
| Q |
219 |
ttgaaccgaattgttttgaaccgaatcaaactgtttcaattcagttttaaaactgtgtaatg |
280 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
42983099 |
ttgaaccgaattgttttgaatcgaaccaaactgtttcaattcaattttagaactgtgtaatg |
42983160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 219 - 256
Target Start/End: Complemental strand, 43955503 - 43955466
Alignment:
| Q |
219 |
ttgaaccgaattgttttgaaccgaatcaaactgtttca |
256 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
43955503 |
ttgaaccgaactgttttgaaccgaatcgaactgtttca |
43955466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 40654258 - 40654311
Alignment:
| Q |
221 |
gaaccgaattgttttgaaccgaatcaaactgtttcaattcagttttaaaactgt |
274 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||| |||||||| |||||||| |
|
|
| T |
40654258 |
gaactgaattgttttgaactgaactaaactgtttcagttcagtttcaaaactgt |
40654311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University