View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6566_high_5 (Length: 246)
Name: NF6566_high_5
Description: NF6566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6566_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 44203639 - 44203404
Alignment:
| Q |
11 |
caaaggtaatatgtggaactgacgtgnnnnnnngaaactgatttgcaagtttctgtggttatgtcttaattactattttcgaatcgtctgaaataatgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44203639 |
caaaggtaatatgtggaactgacgtgaaaaaaagaaactgatttgcaagtttctgtggttatgtcttaattactattttcgaattgtctgaaataatgat |
44203540 |
T |
 |
| Q |
111 |
ttgctataactagtctgctgtttgacattgcttttcatccaaccaagtcttaaggaaatgaaagtgaaaagattgaacaagatggaaatagtagcaaaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44203539 |
ttgctataactagtctgctgtttgacattgcttttcatccaaccaagtcttaaggaaatgaaagtgaaaagattgaacaagatggaaataggagcaaaga |
44203440 |
T |
 |
| Q |
211 |
atgacatgtctaaacatgatgcttgatttagaataa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
44203439 |
atgacatgtctaaacatgatgcttgatttagaataa |
44203404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University