View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6566_low_9 (Length: 230)
Name: NF6566_low_9
Description: NF6566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6566_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 12 - 161
Target Start/End: Complemental strand, 47362077 - 47361928
Alignment:
| Q |
12 |
agcagagagaagttgcattgaccgtgtgtcgacgatggagattgaactgccggaagggaatgcgaggaggccgttggggtttagatctgaggatccgaag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47362077 |
agcagagagaagttgcattgaccgtgtgtcgacgatggagattgaactgccggaagggaatgcgaggaggccgttggggtttagatctgaggatccgaag |
47361978 |
T |
|
| Q |
112 |
ttgttgcggcttgatggacctgggagcattgattcccatgattcttgtgg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47361977 |
ttgttgcggcttgatggacctgggagcattgattcccatgattcttgtgg |
47361928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University