View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6567_low_27 (Length: 318)
Name: NF6567_low_27
Description: NF6567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6567_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 8e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 123 - 300
Target Start/End: Original strand, 14175761 - 14175938
Alignment:
| Q |
123 |
gaagcttgatattgggattagcgaatcataatcgtttatcggctaaaattgaggtgggttcctttaggtttagcattaccaaatgtatttagtgtttggc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14175761 |
gaagcttgatattgggattagcgaatcataatcgtttatcggctaaaattgaggtgggttcctttaggtttagcattaccaaatgtatttagtgtttggc |
14175860 |
T |
 |
| Q |
223 |
caatttatgattagttactaactataggtttagataccaatataagaggagtgctaggtacccttgtactcctaatat |
300 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14175861 |
caatttatgattagttattaactataggtttagataccaaaataaaaggagtgctaggtacccttgtactcctaatat |
14175938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 41 - 95
Target Start/End: Original strand, 14175714 - 14175768
Alignment:
| Q |
41 |
ttggtaagagtttggattgatggttggactgaatttgcagcttgcgggaggcttg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
14175714 |
ttggtaagagtttggattgatggttggactgaatttggagcttgcgggaagcttg |
14175768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University