View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6567_low_30 (Length: 258)
Name: NF6567_low_30
Description: NF6567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6567_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 10 - 251
Target Start/End: Original strand, 27325362 - 27325603
Alignment:
| Q |
10 |
catactatttaaacgtgattttgtactatgtaacccctaaacattgcataatataaaactataattagccaaagtttgaagtggaatgagctgtatgcaa |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27325362 |
catactatttaaacatgattttgtactatgtaacccctaaacattgcataatataaaactataattagccaaagtttgaagtggaatgagctgtatgcaa |
27325461 |
T |
 |
| Q |
110 |
atatcaactcttgtaccttgttcaacattacatccaaaatattaaatttcacctcagcgtgcacaattgaccggactccatgatcaatcattgtattttt |
209 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27325462 |
atatcaactcttgtaccgtgttcaacattacatccaaaatattaaatttcacctcagtgtgcacaattgaccggactccatgatcaatcattgtattttt |
27325561 |
T |
 |
| Q |
210 |
gtgtgattatattattactttagagccagatttcctatgcta |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27325562 |
gtgtgattatcttattactttagagccagatttcctatgcta |
27325603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 167
Target Start/End: Complemental strand, 27325151 - 27325076
Alignment:
| Q |
92 |
ggaatgagctgtatgcaaatatcaactcttgtaccttgttcaacattacatccaaaatattaaatttcacctcagc |
167 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| ||||| | ||||| |||||||||||||||||| ||||||| |
|
|
| T |
27325151 |
ggaatgagctatatgcaaatatcagctcttgtactttgttgagcattagatccaaaatattaaattttgcctcagc |
27325076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University