View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6567_low_33 (Length: 236)
Name: NF6567_low_33
Description: NF6567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6567_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 218
Target Start/End: Complemental strand, 31314274 - 31314078
Alignment:
| Q |
20 |
ataggtagggtagttacctaaagttagttatatggtatgggcctgccctgccctgccctctatttctacctatatcctctggtggaaggtataataatca |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31314274 |
ataggtagggtagttgcctaaagttagttatatggtatgg-cctgccccgccctgccctctatttctacctatatcctctggtggaaggtataataatca |
31314176 |
T |
 |
| Q |
120 |
agaaatgattaaagttgattagggagaaatctctatccccatccccaaataatgaaacaaacaagcttaga-tttagtcaattgtatatccctttctttc |
218 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
31314175 |
agaaatgatgaaa--tgattagggagaaatctctatccccatcaccaaataatgaaacaaacaagcttagattttagtcaattgcatatccctttctttc |
31314078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University