View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6567_low_37 (Length: 212)
Name: NF6567_low_37
Description: NF6567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6567_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 49943264 - 49943091
Alignment:
| Q |
17 |
tagggatcttagggttcagcctgatgagtctgaagagggttcaaccctttagctagcttgtgttgtgttgtgactattcagtactagagtagagtgtaat |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49943264 |
taggggtcttagggttcagcctgatgagtctgaagagggttcaaccctttagctagcttgtgttgtgttgtgactattcaatactagagtagagtgtaat |
49943165 |
T |
 |
| Q |
117 |
ggtgtccgggaatgccaaccaacaagaatgttttggttcgttttctgactcacaattggtgtgactgtgttgcc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49943164 |
ggtgtccgggaatgccaaccaacaagaatgttttggttcgttttctgactcacaattggtgtgactgtgttgcc |
49943091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University