View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6568_high_19 (Length: 257)
Name: NF6568_high_19
Description: NF6568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6568_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 2176582 - 2176453
Alignment:
| Q |
1 |
attgtatatattgtctacacattttgcaagaacagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2176582 |
attgtatatattgtctacacattttgcaagaacagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatg |
2176483 |
T |
 |
| Q |
101 |
actgataatttgtattttcaacatctaact |
130 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
2176482 |
actgataatttgtcttttcaacatctaact |
2176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 2176388 - 2176340
Alignment:
| Q |
195 |
gttttacttctaagaacaatttattcgagtcaatcagttaattattgat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2176388 |
gttttacttctaagaacaatttattcgagtcaatcagttaattattgat |
2176340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University