View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6568_high_20 (Length: 244)
Name: NF6568_high_20
Description: NF6568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6568_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 32847918 - 32847745
Alignment:
| Q |
1 |
ctgagcctgttctaagtaataggcaagatattatattctttaggttctgctggtggggaccttgtttgtgtcattttggtactattatgactgaaactat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||| | ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32847918 |
ctgagcctgttctaggtaataggcaacacattatattctttaggttctgccggtggggaccttgtttgtgtcattttggtactattatgactgaaactat |
32847819 |
T |
 |
| Q |
101 |
gcgtgttgaatcagataatgtggtttagtttatttaggtctaaatgaatgccaatataaaataggtgtgtgatg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32847818 |
gcgtgttgaatcagataatgtggtttagtttatttagatctaaatgaatgccaatataaaataggagtgtgatg |
32847745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 191 - 227
Target Start/End: Complemental strand, 32847566 - 32847530
Alignment:
| Q |
191 |
atatcggtctgtatgattaggaatatgataaagctta |
227 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32847566 |
atatcggtttgtatgattaggaatatgataaagctta |
32847530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University