View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6568_low_20 (Length: 257)

Name: NF6568_low_20
Description: NF6568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6568_low_20
NF6568_low_20
[»] chr5 (2 HSPs)
chr5 (1-130)||(2176453-2176582)
chr5 (195-243)||(2176340-2176388)


Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 2176582 - 2176453
Alignment:
1 attgtatatattgtctacacattttgcaagaacagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacatnnnnnnntg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||    
2176582 attgtatatattgtctacacattttgcaagaacagagaaatgctaatttgatatcttatcaatttcaatatgaaagtagttttagcaacataaaaaaatg 2176483  T
101 actgataatttgtattttcaacatctaact 130  Q
    ||||||||||||| ||||||||||||||||    
2176482 actgataatttgtcttttcaacatctaact 2176453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 195 - 243
Target Start/End: Complemental strand, 2176388 - 2176340
Alignment:
195 gttttacttctaagaacaatttattcgagtcaatcagttaattattgat 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
2176388 gttttacttctaagaacaatttattcgagtcaatcagttaattattgat 2176340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University