View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6568_low_23 (Length: 240)
Name: NF6568_low_23
Description: NF6568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6568_low_23 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 32481472 - 32481251
Alignment:
| Q |
19 |
acccctaagggtcaattttggagttgggagtggaaaggtgtggaggtgttgagaggaaagcaaggaagaaagggaagtgaggttagtccccaaccttaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
32481472 |
acccctaagggtcaattttggagttgggagtggaaaggtgtggaggtgttgagaggaaagcaaggaagaaagggaagggaggatagtccccaaccttaca |
32481373 |
T |
|
| Q |
119 |
tagagtttatttttcttcataggactaaaatctccaaattttgaggaactcaaaaaatgaattgatgaaggattttgaaggtctttggacaatttcccaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32481372 |
tagagtttatttttcttcataggactaaaatctccaaattttgaggaactcaaaaaatgaattgatgaaggattttgaaggtctttggacaatttcccaa |
32481273 |
T |
|
| Q |
219 |
atcacttccctctttataatac |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32481272 |
atcacttccctctttataatac |
32481251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University