View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6568_low_24 (Length: 239)
Name: NF6568_low_24
Description: NF6568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6568_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 3 - 222
Target Start/End: Complemental strand, 19400715 - 19400493
Alignment:
| Q |
3 |
tgtacgtgtttgtagaagtaaatattttaatgaataagaatattataagtaagttaaatagtagttaaaaggcaattaaaaatatgaaaattgtcgtaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19400715 |
tgtacgtgtttgtagaagtaaatattttaatgaataagagtattataagtaagttaaatagtagttaaaagacaattaaaaatatgaaaattgtcgtaaa |
19400616 |
T |
 |
| Q |
103 |
acttggcaatgtgcataatatatttattaaagcataacaaaaactagggatgttggt---tatttgattggaaatacatattatagttagttgaaatttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19400615 |
acttggcaatgtgcataatatatttattaaagcataacaaaaattaaggatgttggttattatttgattggaaatacatattatagttagttgaaatttt |
19400516 |
T |
 |
| Q |
200 |
gtcttaaaggtagagaatacttg |
222 |
Q |
| |
|
|||| |||| | ||||||||||| |
|
|
| T |
19400515 |
gtctgaaagatggagaatacttg |
19400493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University